MLST loci to be used for strain typing of C. neoformans/C. gattii species complex - 2012 (1)

Locus

Locus name

Chromosome Locationa

Primer Name and Sequence

(If not specified differently primers listed will work for C.n.and C.g.)

Amplification conditions

No. of bases analysed (bp)a

Analysed sequence fragment, start ( 5') and end ( 3') pointsa

Ref.

CAP59

Capsular associated protein

1

CAP59F 5' CTCTACGTCGAGCAAGTCAAG 3'

CAP59R 5' TCCGCTGCACAAGTGATACCC 3'

94°C 3min; 35 cycles: 94oC 30s, 5 6 o C 30s, 72oC 1min

Alternative conditions:

30 cycles: 94oC 30s, 64oC 30s, 72oC 1min

or:

30 cycles: 95°C 3min, 95oC 30s, 54oC 30s, 72oC 1min

559

5' – ACGGTACGCGCC

GGAGACAGAATG - 3'

Alternative primers:

CAP59LF 5' GTGAACAAGCTGCGGC 3'

CAP59LR 5' GGATTCAGTGTGGTGGAAGA 3'

35 cycles: 94oC 30s, 60oC 30s, 72oC 1min

1

GPD1

Glyceraldehyde-3-phosphate dehydrogenase

7

GPD1F 5' CCACCGAACCCTTCTAGGATA 3'

GPD1R 5' CTTCTTGGCACCTCCCTTGAG 3'

Alternative primers:

GPD1CnF 5' ATGGTCGTCAAGGTTGGAAT 3'

GPD1CnR 5' GTATTCGGCACCAGCCTCA 3'

94°C 3min; 35 cycles: 94oC 45s, 63oC 1min, 72oC 2min

Alternative conditions:

12 cycles; 62- 56°C step-down 2°C every 2 cycles 95°C 3 min; 95°C 30 sec, 62- 56°C 30 sec, 72°C 1 min; followed by 25 cycles: 95°C 30 sec, 56°C 30 sec, 72°C1 min

543

5' – GGTTTCGGTACG

GGACCCTGCCAA - 3'

2

LAC1

Laccase

8

LAC1F 5' AACATGTTCCCTGGGCCTGTG 3'

LAC1R 5' ATGAGAATTGAATCGCCTTGT 3'

Alternative primers:

LAC1CnF 5' GGCGATACTATTATCGTA 3'

LAC1CnR 5' TTCTGGAGTGGCTAGAGC 3'

94°C 3min; 30 cycles: 94oC 30s, 58oC 30s, 72oC 1min

Alternative conditions:

30 cycles: 95oC 30s, 50oC 30s, 72oC 1min

469

5' – GTAAGTATCAGC

TCAAGCTAAACA- 3'

2

PLB1

Phospholipase

12

PLB1F 5' CTTCAGGCGGAGAGAGGTTT 3'

PLB1R 5' GATTTGGCGTTGGTTTCAGT 3'

94°C 3min; 30 cycles: 94oC 45s, 61oC 45s, 72oC 1min

Alternative conditions:

12 cycles; 62- 56°C step-down 2°C every 2 cycles 95°C 3 min; 95°C 30 sec, 62- 56°C 30 sec, 72°C 1 min; followed by 25 cycles: 95°C 30 sec, 56°C 30 sec, 72°C1 min

532

5' – TGTTACTTGGAT

TCTGGAACATCG- 3'

3

SOD1

Cu, Zn superoxide dismutase

5

Primers for C.n.

SOD1CNF 5' AAGCCTCTCATCCATATCTT 3'

SOD1CNR 5' TTCAACCACGAATATGTA 3'

Primers for C.g.

SOD1CGF 5' GATCCTCACGCCATTACG 3'

SOD1CGR 5' GAATGATGCGCTTAGTTGGA 3'

94°C 3min; 35 cycles: 94oC 30s, 52oC 30s, 72oC 1.5min

700

For C. gattii:

5' –CCACGTGCTCGC

A CCTGTCAATGC - 3'

Alternative primers for C.n.:

SOD1-f 5'TCTAATCGAAATGGTCAAGG 3'

SOD1-r 5' CGCAGCTGTTCGTCTGGATA 3'

12 cycles; 62- 56°C step-down 2°C every 2 cycles 95°C 3 min; 95°C 30 sec, 62-56C° 30 sec, 72C°1 min; followed by 25 cycles: 95°C 30 sec, 56°C 30 sec, 72°C1 min

535

For C. neoformans:

5' – ATCGCTCACCGC

TGCCCATTGTCA - 3'

3

URA5

Orotidine monophosphate pyrophosphorylase

8

URA5F 5' ATGTCCTCCCAAGCCCTCGAC 3'

URA5R 5' TTAAGACCTCTGAACACCGTACTC 3'

94°C 3min; 35 cycles: 94oC 45s, 63oC 1min, 72oC 2min

Alternative conditions:

30 cycles: 94oC 45s, 63oC 1min, 72oC 2min (C.n.)

26 cycles: 94oC 30 s, 68oC 30s, 72oC 30s (C.g.)

or:

30 cycles: 95°C 3 min; 95°C 30 sec, 63°C 30 sec, 72°C 1min

601

5' – TTTTCGGCAACT

CTTGGAAAGCTC - 3'

5

IGS1

Ribosomal RNA intergenic spacer

2

IGSF 5' ATCCTTTGCAGACGACTTGA 3'

IGSR 5' GTGATCAGTGCATTGCATGA 3'

94°C 3min; 35 cycles: 94oC 30s, 60oC 30s, 72oC 1min

Alternative conditions:

30 cycles: 94oC 30s, 56oC 30s, 72oC 1min

723

5' – TAAGCCCTTGTT

AAAGATTTATTG - 3'

3

1. W Meyer, D. M. Aanensen, T. Boekhout, M. Cogliati, M. Diaz, M. E. Esposto, M. Fisher, F. Gilgado, F. Hagen, S. Kaocharoen, A. P. Litvintseva, T. G. Mitchell, S. P. Simwami, L. Trilles, M. A. Viviani, and J. Kwon-Chung. 2009. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii.Med Mycol [2009 Jun 12:1-14. Epub ahead of print]

2. Fraser, J. A., S. S. Giles, E. C. Wenink, S. G. Geunes-Boyer, J. R. Wright, S. Diezmann, A. Allen, J. E. Stajich, F. S. Dietrich, J. R. Perfect and J. Heitman. 2005. Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437:1360-1364.

3. Litvintseva, A. P., R. Thakur, R. Vilgalys, and T. G. Mitchell. 2006. Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172:2223-2238.

4. D'Souza, C. A., F. Hagen, T. Boekhout, G. M. Cox, and J. Heitman. 2004. Investigation of the basis of virulence in serotype A strains of Cryptococcus neoformans from apparently immunocompetent individuals. Curr Genet 46:92-102.

5. Meyer, W., A. Castaneda, S. Jackson, M. Huynh, and E. Castañeda. 2003. Molecular typing of IberoAmerican Cryptococcus neoformans isolates. EID 9:189-195.