MLST loci to be used for strain typing of P. jirovecii

Locus

Locus name

Primers

PCR conditions

Fragment size

Reference

B-tubulin

B-tubulin

BTubF: 5´TCATTAGGTGGTGGAACGGG 3´

BTubR: 5´ATCACCATATCCTGGATCCG 3´

94°C 3min; 40 cycles: 94°C 30s, 62°C 1min, 72°C 1min; 72°C 5min

291 bp

(10

DHPS

Dihydropteroate synthase

DHPS3: 5´GCGCCTACACATATTATGGCCATTTTAAATC 3´

DHPS4:                   5´GGAACTTTCAACTTGGCAACCAC 3´ 

95°C 10min; 10 cycles: 94°C 15s, 72°C 30s (decrease 1°C per cycle), 72°C 15s; 40 cycles: 92°C 15s, 62°C 30s,72°C 15s; 72°C 5min

351 bp

(2)

mtLSU

Mitochondrial 26S rRNA

mt26SF:5´GATGGCTGTTTCCAAGCCCA 3´

mt26SR: 5´GTGTACGTTGCAAAGTACTC 3´  

94°C 3min; 40 cycles: 94°C 30s, 52°C 1min, 72°C 1min; 72°C 5min

295 bp

(1)

ITS

Internal transcribed spacer of the rRNA gene

First round
1724F2
: 5´AGTTGATCAAATTTGGTCATTTAGAG 3´

ITS2R: 5´CTCGGACGAGGATCCTCGCC 3´

Second round
ITS1F2
: 5´CGTAGGTGAACCTGCGGAAGGATC 3´

ITS2R1: 5´GTTCAGCGGGTGATCCTGCCTG 3´

First round
96°C 5min; 25 cycles: 94°C 1min, 60°C 1min, 72°C 4.5min; 72°C 7min

Second round
94°C 5min; 20 cycles: 94°C 1min, 56°C 1min, 72°C 4.5min; 72°C 7min

481 bp

(3-5)

1. Gianella S, et al. 2010. Molecular evidence of interhuman transmission in an outbreak of Pneumocystis jirovecii pneumonia among renal transplant recipients. Transplant Infectious Disease; 12:1-10.

2. Montes-Cano MA, et al. 2004. Pneumocystis jirovecii genotypes in the Spanish Population. CID;34:123-8.

3. Lee CH, et al. 1998. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes. J Clin Micro;36:734-41.

4. Beser J, et al. 2007. Frequent in vitro recombination in internal transcribed spacer 1 and 2 during genotyping Pneumocystis jirovecii. J Clin Micro;45:881-6.

5. van Hal S, et al. 2009. Clinical significance and phylogenetic relationship of novel Australian Pneumocystis jirovecii genotypes. J Clin Micro;47:1818-23.