MLST loci to be used for strain typing of S. apiospermum and S. boydii

Locus

Locus name

Primer name and sequence*

Amplification conditions

Fragment size

Ref.

ACT

Actin

Forward: ACT-1 5' TGGGACGATATGGAIAAIATCTGGCA 3'

Reverse: ACT-4R 5' TCITCGTATTCTTGCTTIGAIATCCACAT 3'

94ºC 5 min; 35 cycles: 95ºC 30s, 57ºC 30s, 72ºC 1 min; 72ºC 7 min

1000 bp

1

CAL

Calmodulin

Forward CAL-FW 5' GACTATTCACTAACAACGCTGTG 3'

Reverse CAL-RW 5' GTCTAGTATAATCAAATCGTTAGAG 3'

94ºC 5 min; 35 cycles: 95ºC 30s, 55ºC 30s, 72ºC 1 min; 72ºC 7 min

650 bp 

Own

RPB2

RNA polymerase II subunit

Forward RPB2-5F 5' GAYGAYMGWGATCAYTTYGG 3'

Reverse RPB2-7R 5' CCCATRGCTTGYTTRCCCAT 3'

95ºC 5 min; 35 cycles: 95ºC 30s, 55ºC 30s, 72ºC 1 min; 72ºC 7 min

1300 bp

2

SOD2

Manganese superoxide dismutase

Forward SOD2F3 5' TCACCACGATAAACACCACC 3'

Reverse SOD2R3 5' CGTCGATACCCAAGAGAGGA 3'

95ºC 5 min; 35 cycles: 95ºC 30s, 52ºC 30s, 72ºC 1 min; 72ºC 7 min

550 bp

3

BT2

Beta-tubulin

Forward BT2a 5' GGTAACCAAATCGGTGCTGCTTTC 3'

Reverse BT2b 5' ACCCTCAGTGTAGTGACCCTTGGC 3'

95ºC 5 min; 35 cycles: 95ºC 30s, 58ºC 30s, 72ºC 1 min; 72ºC 7 min

650 bp 

4

*R: G or A; W: A or T; Y: C or T; M: A or C.

1. Hoffmann K, Discher S and Voigt K. Revision of the genus Absidia (Mucorales, Zygomycetes) based on physiological, phylogenetic, and morphological characters; thermotolerant Absidia spp. form a coherent group, Mycocladiaceae fam. nov. Mycological Research 2007; 111: 1169-1183.

2. Liu Y, Whelen S, Hall B. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999. 16(12): 1799-1808.

3. Harun A, Gilgado F, Perdomo H, Losert H, Kamarudin B, Chan YY, Abdullah S, Kaltseis J, Fraser M, Blyth CC, Arthur I, Buzina W, Rainer J, Cano J, Guarro J, Tintelnot K, Slavin MA, Heath C, Chen SCA, Meyer W. Development and application of a new multilocus sequence typing (MLST)scheme reveals extensive genetic diversity within the emerging pathogenic fungal species Scedosporium aurantiacum. In preparation.

4. Glass NL, Donaldson GC. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and environmental microbiology. 1995;61(4):1323-30. Epub 1995/04/01.