MLST loci to be used for strain typing of S. aurantiacum

Locus

Locus name

Primer name and sequence *

Amplification conditions

Fragment size

Ref.

ACT

Actin

Forward: ACT-1 5´ TGGGACGATATGGAIAAIATCTGGCA 3´

Reverse: ACT-4R 5´ TCITCGTATTCTTGCTTIGAIATCCACAT 3´

94ºC 5 min; 35 cycles: 95ºC 30s, 60ºC 1 min, 72ºC 1 min; 72ºC 7 min

950 bp

1

CAL

Calmodulin

Forward CL1 5' GARTWCAAGGAGGCCTTCTC 3'

Reverse CL2A 5' TTTTTGCATCATGAGTTGGAC 3'

94ºC 5 min; 35 cycles: 94ºC 45s, 52ºC 45s, 72ºC 1 min; 72ºC 7 min

650 bp 

2

EF1a

Translational elongation factor 1a

Forward EF-1 5' ATGGGTAAGGARGACAAGAC 3'

Reverse EF-2 5' GGARGTACCAGTSATCATGTT 3'

94ºC 3 min; 35 cycles: 94ºC 45s, 50ºC 45s, 72ºC 1 min; 72ºC 7 min

850 bp 

3

RPB2

RNA polymerase II subunit

Forward RPB2-5F 5' GAYGAYMGWGATCAYTTYGG 3'

Reverse RPB2-7R 5' CCCATRGCTTGYTTRCCCAT 3'

94ºC 5 min; 35 cycles: 95ºC 30s, 55ºC 1 min, 72ºC 1 min; 72ºC 7 min

1200 bp

4

SOD2

Manganese superoxide dismutase

Forward SOD2F3 5' TCACCACGATAAACACCACC 3'

Reverse SOD2R3 5' CGTCGATACCCAAGAGAGGA 3'

94ºC 3 min; 35 cycles: 95ºC 45s, 52ºC 45s, 72ºC 1 min; 72ºC 7 min

500 bp

Own

TUB

Beta-tubulin

Forward TUB2F 5' CTGTCCAACCCCTCTTACGGCGACCTGAAC 3'

Reverse TUB2R 5' ACCCTCACCAGTATACCAATGCAAGAAAGC 3'

94ºC 5 min; 35 cycles: 95ºC 30s, 55ºC 1 min, 72ºC 1 min; 72ºC 7 min

650 bp 

5

*R: G or A; W: A or T; S: C or G ; Y: C or T; M: A or C.

1. Hoffmann K, Discher S and Voigt K. Revision of the genus Absidia (Mucorales, Zygomycetes) based on physiological, phylogenetic, and morphological characters; thermotolerant Absidia spp. form a coherent group, Mycocladiaceae fam. nov. Mycological Research 2007; 111: 1169-1183.

2. Gilgado F, Cano J, Gené J and Guarro J. Molecular phylogeny of the Pseudallescheria boydii species complex: Proposal of two new species. J Clin Microbiol 2005; 43 (10): 4930-4942.

3. O'Donnell K, Kistler HC, Cigelnik E, Ploetz RC. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc Natl Acad Sci USA 1998; 95: 2044-2049.

4. Liu Y, Whelen S, Hall B. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999. 16(12): 1799-1808.

5. Cruse M, Telerant R, Gallagher T, Lee T and Taylor J. Cryptic species in Stachybotrys chartarum. Mycologia 2002;94(5): 814-822.